an academic website of the in association with
GeneLoc Home GeneCards Home MalaCards Home About GeneLoc Contact Us

MarkerCard for AFMb302yd9


Location

Synonyms
  • w6492
  • RH9768
  • STS2640
  • D17S1843
  • AFMb302yd9a
  • AFMb302yd9m
  • AFMb302yd9a/AFMb302yd9m

Marker types
  • Polymorphic marker
  • STS mapped on YAC contig

External Links --
Radiation Hybrid Mapping

According to:
--

Linkage Mapping

According to:
Entry AFMb302yd9 from Genethon
Location:44.0 cM
Heterozygosity:0.69
Number of Alleles:9
Allele Size Range:183 - 203 bp
Entry AFMb302yd9 from Marshfield
Location:41.12 cM
Heterozygosity:0.70
Allele Size Range:183 - 203 bp
STS to YAC Content Mapping

According to:
Entry AFMB302YD9 from Whitehead
YAC Contig Name:WC17.3
Sequences

According to:

Entry AFMb302yd9 from Genethon
CA strand primer:AATTCAAAGGCTAAAAGCAAAC
GT strand primer:GAGAATCACCTGAACCCG
Allele Size Range:183 - 203 bp
Full Sequence

Entry AFMB302YD9 from Whitehead
Left strand primer:AATTCAAAGGCTAAAAGCAAAC
Right strand primer:GAGAATCACCTGAACCCG
Product Size:189

Primer 1:AATTCAAAGGCTAAAAGCAAAC
Primer 2:GAGAATCACCTGAACCCG
Product Size:189



   Back to GeneLoc Home Page